Values CatLog read from this paper

Kinetics study reveals interconnected relationships of component activities in trifunctional RNA capping enzymes

PMID 42248456doi:10.1016/j.jbc.2026.113237Open in Browse

The paper itself is not on this site: read it at the publisher. This page lists only the values CatLog read from it.

CatLog read 10 records (30 values) from this paper: Faustovirus RNA capping enzyme (FCE), Vaccinia virus RNA capping enzyme (VCE) from Faustovirus, Vaccinia virus.

Read from the paper by an AI model and checked against the paper by a second, separate AI run; code converted the units. Values are in CatLog's units; each record opens in Browse with the line the paper prints and the checks.

Records read from this paper
Enzyme	Organism	Substrate	k_cat (s⁻¹)	K_m (mM)	k_cat/K_m (mM⁻¹ s⁻¹)	Conditions	Open record
Faustovirus RNA capping enzyme (FCE)	Faustovirus	5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)isolated guanylyltransferase (GTase) reaction	1.1	3.158 × 10⁻⁴	3.6 × 10³	25 °C	Open record: Faustovirus RNA capping enzyme (FCE), 5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Faustovirus RNA capping enzyme (FCE)	Faustovirus	5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)no SAM	1.3	3.556 × 10⁻⁴	3.5 × 10³	25 °C	Open record: Faustovirus RNA capping enzyme (FCE), 5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Faustovirus RNA capping enzyme (FCE)	Faustovirus	5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)isolated N7-methyltransferase (N7-MTase) reaction; SAM only	0.38	3.47 × 10⁻⁵	1.1 × 10⁴	25 °C	Open record: Faustovirus RNA capping enzyme (FCE), 5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Faustovirus RNA capping enzyme (FCE)	Faustovirus	5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)15 U qCIP and 6 U apyrase; no SAM or GTP	0.07	2.237 × 10⁻⁴	310	25 °C	Open record: Faustovirus RNA capping enzyme (FCE), 5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Faustovirus RNA capping enzyme (FCE)	Faustovirus	5'-triphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)	2.6	1.739 × 10⁻⁴	1.5 × 10⁴	25 °C	Open record: Faustovirus RNA capping enzyme (FCE), 5'-triphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Vaccinia virus RNA capping enzyme (VCE)	Vaccinia virus	5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)isolated guanylyltransferase (GTase) reaction	0.09	7.03 × 10⁻⁵	1.2 × 10³	25 °C	Open record: Vaccinia virus RNA capping enzyme (VCE), 5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Vaccinia virus RNA capping enzyme (VCE)	Vaccinia virus	5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)no SAM	0.08	7.48 × 10⁻⁵	1.4 × 10³	25 °C	Open record: Vaccinia virus RNA capping enzyme (VCE), 5'-diphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Vaccinia virus RNA capping enzyme (VCE)	Vaccinia virus	5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)isolated N7-methyltransferase (N7-MTase) reaction; SAM only	0.1	3.67 × 10⁻⁵	2.6 × 10³	25 °C	Open record: Vaccinia virus RNA capping enzyme (VCE), 5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Vaccinia virus RNA capping enzyme (VCE)	Vaccinia virus	5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)15 U qCIP and 6 U apyrase; no SAM or GTP	0.09	2.818 × 10⁻⁴	340	25 °C	Open record: Vaccinia virus RNA capping enzyme (VCE), 5'-guanylylated (GpppN-capped) RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)
Vaccinia virus RNA capping enzyme (VCE)	Vaccinia virus	5'-triphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)	1	8.75 × 10⁻⁵	1.1 × 10⁴	25 °C	Open record: Vaccinia virus RNA capping enzyme (VCE), 5'-triphosphate RNA oligonucleotide (25 nt, GUAGAACUUCGUCGAGUACGCUCAA, 3'-6-FAM labelled)